Molecular prevalence of Anaplasma marginale in ruminants and Rhipicephalus ticks in northern Pakistan

@#Anaplasma marginale is the most prevalent tick-borne haemoparasite of cattle and causes huge economic losses to the dairy industry worldwide. This study aimed to determine the occurrence of A. marginale infection in blood and tick samples collected from livestock animals in the districts located in Khyber Pakhtunkhwa (KPK), Pakistan. A total of 184 blood and 370 tick samples were included in this study. It has never been reported that sheep, goats, and cattle in Tank, Ghulam Khan, Birmil and Miran Shah areas were infected with A. marginale. All samples of blood and ticks were collected through random sampling from March 2021 to January 2022 from cattle, sheep and goats and screened through PCR for anaplasmosis by using primer pairs of Anaplasma spp. Three hundred and seventy ticks were collected from infested hosts (120/184, 64.21%). Among the four morphologically identified tick species, the highest occurrence was recorded for Rhipicephalus sanguineus (n=138, 37.29%), followed by Rhipicephalus microplus (n=131, 35.4%), Rhipicephalus annulatus (n=40, 10.81%), Hyalomma anatolicum (n=31, 8.37%), and Hyalomma marginatum (n=30, 8.1%). The occurrence of female tick was highest (n=160, 43.24%), followed by nymphs (n=140, 37.38%) and males ticks (n=70, 18.9%). Among these ticks, A. marginale was detected in female ticks of R. microplus, and R. sanguineus. Molecular identification of A. marginale was confirmed in 120 out of 184 blood samples and 6 out of 74 tick samples. Overall, occurrence of A. marginale in blood and tick samples was found to be 65.21% and 8.1% respectively. Species-wise occurrence in blood samples of goats were 71.11% followed by sheep 68.31% and cattle 50%. Specie-wise occurrence of A. marginale in tick samples of cattle were 12.5% followed by goats 6.89%. The obtained sequence showed similarity with A. marginale reported from Kenya and USA. We report the first PCR based detection of A. marginale infection in blood samples and in R. sanguineus ticks of goats simultaneously.

Escherichia coli expression and characterization of α-amylase from Geobacillus thermodenitrificans DSM-465 / Expressão e caracterização de Escherichia coli de alfa-amilase de Geobacillus thermodenitrificans DSM-465

Alpha amylase, catalyzing the hydrolysis of starch is a ubiquitous enzyme with tremendous industrial applications. A 1698 bp gene coding for 565 amino acid amylase was PCR amplified from Geobacillus thermodenitrificans DSM465, cloned in pET21a (+) plasmid, expressed in BL21 (DE3) strain of E. coli and characterized. The recombinant enzyme exhibited molecular weight of 63 kDa, optimum pH 8, optimum temperature 70°C, and KM value of 157.7µM. On pilot scale, the purified enzyme efficiently removed up to 95% starch from the cotton fabric indicating its desizing ability at high temperature. 3D model of enzyme built by Raptor-X and validated by Ramachandran plot appeared as a monomer having 31% α-helices, 15% ß-sheets, and 52% loops. Docking studies have shown the best binding affinity of enzyme with amylopectin (∆G -10.59). According to our results, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276, and Arg175 constitute the potential active site of enzyme.

A alfa-amilase, que catalisa a hidrólise do amido, é uma enzima ubíqua com imensas aplicações industriais. Um gene de 1698 pb que codifica a amilase de 565 aminoácidos foi amplificado por PCR, a partir de Geobacillus thermodenitrificans DSM-465, clonado no plasmídeo pET21a (+), expresso na cepa BL21 (DE3) de E. coli e caracterizado. A enzima recombinante exibiu peso molecular de 63 kDa, pH ótimo igual a 8, temperatura ótima de 70° C e valor KM de 157,7 µM. Em escala piloto, a enzima purificada removeu com eficiência até 95% de amido do tecido de algodão, indicando sua capacidade de desengomagem em alta temperatura. O modelo 3D da enzima construída por Raptor-X e validada por Ramachandran plot apareceu como um monômero com 31% de hélices alfa, 15% de folhas beta e 52% de loops. Os estudos de docking mostraram melhor afinidade de ligação da enzima com amilopectina (∆G: - 10,59). De acordo com nossos resultados, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276 e Arg175 constituem o sítio ativo potencial da enzima.

Studies on the recombinant production and anticancer activity of thermostable L- asparaginase I from Pyrococcus abyssi / Estudos sobre a produção recombinante e atividade anticancerígena da L-asparaginase I termoestável de Pyrococcus abyssi

L-Asparaginase catalysing the breakdown of L-Asparagine to L-Aspartate and ammonia is an enzyme of therapeutic importance in the treatment of cancer, especially the lymphomas and leukaemia. The present study describes the recombinant production, properties and anticancer potential of enzyme from a hyperthermophilic archaeon Pyrococcus abyssi. There are two genes coding for asparaginase in the genome of this organism. A 918 bp gene encoding 305 amino acids was PCR amplified and cloned in BL21 (DE3) strain of E. coli using pET28a (+) plasmid. The production of recombinant enzyme was induced under 0.5mM IPTG, purified by selective heat denaturation and ion exchange chromatography. Purified enzyme was analyzed for kinetics, in silico structure and anticancer properties. The recombinant enzyme has shown a molecular weight of 33 kDa, specific activity of 1175 U/mg, KM value 2.05mM, optimum temperature and pH 80°C and 8 respectively. No detectable enzyme activity found when L-Glutamine was used as the substrate. In silico studies have shown that the enzyme exists as a homodimer having Arg11, Ala87, Thr110, His112, Gln142, Leu172, and Lys232 being the putative active site residues. The free energy change calculated by molecular docking studies of enzyme and substrate was found as ∆G ­ 4.5 kJ/mole indicating the affinity of enzyme with the substrate. IC50 values of 5U/mL to 7.5U/mL were determined for FB, caco2 cells and HepG2 cells. A calculated amount of enzyme (5U/mL) exhibited 78% to 55% growth inhibition of caco2 and HepG2 cells. In conclusion, the recombinant enzyme produced and characterized in the present study offers a good candidate for the treatment of cancer. The procedures adopted in the present study can be prolonged for in vivo studies.

A L-asparaginase, que catalisa a degradação da L-asparagina em L-aspartato e amônia, é uma enzima de importância terapêutica no tratamento do câncer, especialmente dos linfomas e da leucemia. O presente estudo descreve a produção recombinante, propriedades e potencial anticancerígeno da enzima de Pyrococcus abyssi, um archaeon hipertermofílico. Existem dois genes que codificam para a asparaginase no genoma desse organismo. Um gene de 918 bp, que codifica 305 aminoácidos, foi amplificado por PCR e clonado na cepa BL21 (DE3) de E. coli usando o plasmídeo pET28a (+). A produção da enzima recombinante foi induzida sob 0,5mM de IPTG, purificada por desnaturação seletiva por calor e cromatografia de troca iônica. A enzima purificada foi analisada quanto à cinética, estrutura in silico e propriedades anticancerígenas. A enzima recombinante apresentou peso molecular de 33 kDa, atividade específica de 1.175 U / mg, valor de KM 2,05 mM, temperatura ótima de 80º C e pH 8. Nenhuma atividade enzimática detectável foi encontrada quando a L-glutamina foi usada como substrato. Estudos in silico mostraram que a enzima existe como um homodímero, com Arg11, Ala87, Thr110, His112, Gln142, Leu172 e Lys232 sendo os resíduos do local ativo putativo. A mudança de energia livre calculada por estudos de docking molecular da enzima e do substrato foi encontrada como ∆G ­ 4,5 kJ / mol, indicando a afinidade da enzima com o substrato. Valores de IC50 de 5U / mL a 7,5U / mL foram determinados para células FB, células caco2 e células HepG2. Uma quantidade de enzima (5U / mL) apresentou inibição de crescimento de 78% a 55% das células caco2 e HepG2, respectivamente. Em conclusão, a enzima recombinante produzida e caracterizada no presente estudo é uma boa possibilidade para o tratamento do câncer. Os procedimentos adotados na presente pesquisa podem ser aplicados para estudos in vivo.

Escherichia coli expression and characterization of alfa-amylase from Geobacillus thermodenitrificans DSM-465 / Expressão e caracterização de Escherichia coli de alfa-amilase de Geobacillus thermodenitrificans DSM-465

Alpha amylase, catalyzing the hydrolysis of starch is a ubiquitous enzyme with tremendous industrial applications. A 1698 bp gene coding for 565 amino acid amylase was PCR amplified from Geobacillus thermodenitrificans DSM-465, cloned in pET21a (+) plasmid, expressed in BL21 (DE3) strain of E. coli and characterized. The recombinant enzyme exhibited molecular weight of 63 kDa, optimum pH 8, optimum temperature 70°C, and KM value of 157.7µM. On pilot scale, the purified enzyme efficiently removed up to 95% starch from the cotton fabric indicating its desizing ability at high temperature. 3D model of enzyme built by Raptor-X and validated by Ramachandran plot appeared as a monomer having 31% α-helices, 15% β-sheets, and 52% loops. Docking studies have shown the best binding affinity of enzyme with amylopectin (∆G -10.59). According to our results, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276, and Arg175 constitute the potential active site of enzyme.

A alfa-amilase, que catalisa a hidrólise do amido, é uma enzima ubíqua com imensas aplicações industriais. Um gene de 1698 pb que codifica a amilase de 565 aminoácidos foi amplificado por PCR, a partir de Geobacillus thermodenitrificans DSM-465, clonado no plasmídeo pET21a (+), expresso na cepa BL21 (DE3) de E. coli e caracterizado. A enzima recombinante exibiu peso molecular de 63 kDa, pH ótimo igual a 8, temperatura ótima de 70° C e valor KM de 157,7 µM. Em escala piloto, a enzima purificada removeu com eficiência até 95% de amido do tecido de algodão, indicando sua capacidade de desengomagem em alta temperatura. O modelo 3D da enzima construída por Raptor-X e validada por Ramachandran plot apareceu como um monômero com 31% de hélices alfa, 15% de folhas beta e 52% de loops. Os estudos de docking mostraram melhor afinidade de ligação da enzima com amilopectina (∆G: - 10,59). De acordo com nossos resultados, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276 e Arg175 constituem o sítio ativo potencial da enzima.

Studies on the recombinant production and anticancer activity of thermostable L- asparaginase I from Pyrococcus abyssi / Estudos sobre a produção recombinante e atividade anticancerígena da L asparaginase I termoestável de Pyrococcus abyssi

L-Asparaginase catalysing the breakdown of L-Asparagine to L-Aspartate and ammonia is an enzyme of therapeutic importance in the treatment of cancer, especially the lymphomas and leukaemia. The present study describes the recombinant production, properties and anticancer potential of enzyme from a hyperthermophilic archaeon Pyrococcus abyssi. There are two genes coding for asparaginase in the genome of this organism. A 918 bp gene encoding 305 amino acids was PCR amplified and cloned in BL21 (DE3) strain of E. coli using pET28a (+) plasmid. The production of recombinant enzyme was induced under 0.5mM IPTG, purified by selective heat denaturation and ion exchange chromatography. Purified enzyme was analyzed for kinetics, in silico structure and anticancer properties. The recombinant enzyme has shown a molecular weight of 33 kDa, specific activity of 1175 U/mg, KM value 2.05mM, optimum temperature and pH 80°C and 8 respectively. No detectable enzyme activity found when L-Glutamine was used as the substrate. In silico studies have shown that the enzyme exists as a homodimer having Arg11, Ala87, Thr110, His112, Gln142, Leu172, and Lys232 being the putative active site residues. The free energy change calculated by molecular docking studies of enzyme and substrate was found as ∆G – 4.5 kJ/mole indicating the affinity of enzyme with the substrate. IC50 values of 5U/mL to 7.5U/mL were determined for FB, caco2 cells and HepG2 cells. A calculated amount of enzyme (5U/mL) exhibited 78% to 55% growth inhibition of caco2 and HepG2 cells. In conclusion, the recombinant enzyme produced and characterized in the present study offers a good candidate for the treatment of cancer. The procedures adopted in the present study can be prolonged for in vivo studies.

A L-asparaginase, que catalisa a degradação da L-asparagina em L-aspartato e amônia, é uma enzima de importância terapêutica no tratamento do câncer, especialmente dos linfomas e da leucemia. O presente estudo descreve a produção recombinante, propriedades e potencial anticancerígeno da enzima de Pyrococcus abyssi, um archaeon hipertermofílico. Existem dois genes que codificam para a asparaginase no genoma desse organismo. Um gene de 918 bp, que codifica 305 aminoácidos, foi amplificado por PCR e clonado na cepa BL21 (DE3) de E. coli usando o plasmídeo pET28a (+). A produção da enzima recombinante foi induzida sob 0,5mM de IPTG, purificada por desnaturação seletiva por calor e cromatografia de troca iônica. A enzima purificada foi analisada quanto à cinética, estrutura in silico e propriedades anticancerígenas. A enzima recombinante apresentou peso molecular de 33 kDa, atividade específica de 1.175 U / mg, valor de KM 2,05 mM, temperatura ótima de 80º C e pH 8. Nenhuma atividade enzimática detectável foi encontrada quando a L-glutamina foi usada como substrato. Estudos in silico mostraram que a enzima existe como um homodímero, com Arg11, Ala87, Thr110, His112, Gln142, Leu172 e Lys232 sendo os resíduos do local ativo putativo. A mudança de energia livre calculada por estudos de docking molecular da enzima e do substrato foi encontrada como ∆G – 4,5 kJ / mol, indicando a afinidade da enzima com o substrato. Valores de IC50 de 5U / mL a 7,5U / mL foram determinados para células FB, células caco2 e células HepG2. Uma quantidade de enzima (5U / mL) apresentou inibição de crescimento de 78% a 55% das células caco2 e HepG2, respectivamente. Em conclusão, a enzima recombinante produzida e caracterizada no presente estudo é uma boa possibilidade para o tratamento do câncer. Os procedimentos adotados na presente pesquisa podem ser aplicados para estudos in vivo.

Escherichia coli expression and characterization of -amylase from Geobacillus thermodenitrificans DSM-465

Abstract Alpha amylase, catalyzing the hydrolysis of starch is a ubiquitous enzyme with tremendous industrial applications. A 1698 bp gene coding for 565 amino acid amylase was PCR amplified from Geobacillus thermodenitrificans DSM-465, cloned in pET21a (+) plasmid, expressed in BL21 (DE3) strain of E. coli and characterized. The recombinant enzyme exhibited molecular weight of 63 kDa, optimum pH 8, optimum temperature 70°C, and KM value of 157.7µM. On pilot scale, the purified enzyme efficiently removed up to 95% starch from the cotton fabric indicating its desizing ability at high temperature. 3D model of enzyme built by Raptor-X and validated by Ramachandran plot appeared as a monomer having 31% -helices, 15% -sheets, and 52% loops. Docking studies have shown the best binding affinity of enzyme with amylopectin (G -10.59). According to our results, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276, and Arg175 constitute the potential active site of enzyme.

Resumo A alfa-amilase, que catalisa a hidrólise do amido, é uma enzima ubíqua com imensas aplicações industriais. Um gene de 1698 pb que codifica a amilase de 565 aminoácidos foi amplificado por PCR, a partir de Geobacillus thermodenitrificans DSM-465, clonado no plasmídeo pET21a (+), expresso na cepa BL21 (DE3) de E. coli e caracterizado. A enzima recombinante exibiu peso molecular de 63 kDa, pH ótimo igual a 8, temperatura ótima de 70° C e valor KM de 157,7 µM. Em escala piloto, a enzima purificada removeu com eficiência até 95% de amido do tecido de algodão, indicando sua capacidade de desengomagem em alta temperatura. O modelo 3D da enzima construída por Raptor-X e validada por Ramachandran plot apareceu como um monômero com 31% de hélices alfa, 15% de folhas beta e 52% de loops. Os estudos de docking mostraram melhor afinidade de ligação da enzima com amilopectina (G: - 10,59). De acordo com nossos resultados, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276 e Arg175 constituem o sítio ativo potencial da enzima.

Studies on the recombinant production and anticancer activity of thermostable L- asparaginase I from Pyrococcus abyssi

Abstract L-Asparaginase catalysing the breakdown of L-Asparagine to L-Aspartate and ammonia is an enzyme of therapeutic importance in the treatment of cancer, especially the lymphomas and leukaemia. The present study describes the recombinant production, properties and anticancer potential of enzyme from a hyperthermophilic archaeon Pyrococcus abyssi. There are two genes coding for asparaginase in the genome of this organism. A 918 bp gene encoding 305 amino acids was PCR amplified and cloned in BL21 (DE3) strain of E. coli using pET28a (+) plasmid. The production of recombinant enzyme was induced under 0.5mM IPTG, purified by selective heat denaturation and ion exchange chromatography. Purified enzyme was analyzed for kinetics, in silico structure and anticancer properties. The recombinant enzyme has shown a molecular weight of 33 kDa, specific activity of 1175 U/mg, KM value 2.05mM, optimum temperature and pH 80°C and 8 respectively. No detectable enzyme activity found when L-Glutamine was used as the substrate. In silico studies have shown that the enzyme exists as a homodimer having Arg11, Ala87, Thr110, His112, Gln142, Leu172, and Lys232 being the putative active site residues. The free energy change calculated by molecular docking studies of enzyme and substrate was found as G 4.5 kJ/mole indicating the affinity of enzyme with the substrate. IC50 values of 5U/mL to 7.5U/mL were determined for FB, caco2 cells and HepG2 cells. A calculated amount of enzyme (5U/mL) exhibited 78% to 55% growth inhibition of caco2 and HepG2 cells. In conclusion, the recombinant enzyme produced and characterized in the present study offers a good candidate for the treatment of cancer. The procedures adopted in the present study can be prolonged for in vivo studies.

Resumo A L-asparaginase, que catalisa a degradação da L-asparagina em L-aspartato e amônia, é uma enzima de importância terapêutica no tratamento do câncer, especialmente dos linfomas e da leucemia. O presente estudo descreve a produção recombinante, propriedades e potencial anticancerígeno da enzima de Pyrococcus abyssi, um archaeon hipertermofílico. Existem dois genes que codificam para a asparaginase no genoma desse organismo. Um gene de 918 bp, que codifica 305 aminoácidos, foi amplificado por PCR e clonado na cepa BL21 (DE3) de E. coli usando o plasmídeo pET28a (+). A produção da enzima recombinante foi induzida sob 0,5mM de IPTG, purificada por desnaturação seletiva por calor e cromatografia de troca iônica. A enzima purificada foi analisada quanto à cinética, estrutura in silico e propriedades anticancerígenas. A enzima recombinante apresentou peso molecular de 33 kDa, atividade específica de 1.175 U / mg, valor de KM 2,05 mM, temperatura ótima de 80º C e pH 8. Nenhuma atividade enzimática detectável foi encontrada quando a L-glutamina foi usada como substrato. Estudos in silico mostraram que a enzima existe como um homodímero, com Arg11, Ala87, Thr110, His112, Gln142, Leu172 e Lys232 sendo os resíduos do local ativo putativo. A mudança de energia livre calculada por estudos de docking molecular da enzima e do substrato foi encontrada como G 4,5 kJ / mol, indicando a afinidade da enzima com o substrato. Valores de IC50 de 5U / mL a 7,5U / mL foram determinados para células FB, células caco2 e células HepG2. Uma quantidade de enzima (5U / mL) apresentou inibição de crescimento de 78% a 55% das células caco2 e HepG2, respectivamente. Em conclusão, a enzima recombinante produzida e caracterizada no presente estudo é uma boa possibilidade para o tratamento do câncer. Os procedimentos adotados na presente pesquisa podem ser aplicados para estudos in vivo.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Prevalence and chemotherapy of babesiosis among Lohi sheep in the Livestock Experiment Station, Qadirabad, Pakistan, and environs

A total of 310 blood smears were collected from sheep of the Livestock Experiment Station, Qadirabad, Sahiwal district, Pakistan, and surrounding areas. The samples were examined microscopically and 30 (9.67 percent) were positive for babesiosis. The animals were divided into two groups (A and B) for chemotherapy. Group A sheep were treated with diminazene diaceturate while group B animals received imidocarb dipropionate. Drug efficacy was determined by negative blood smear examination. Diminazene diaceturate effectiveness against babesiosis was 80 percent while that of imidocarb dipropionate was 100 percent. Hematological studies revealed a significant decrease in hemoglobin concentrations and hematocrit values for Babesia-positive animals compared to healthy controls.(AU)

Bony hydatid disease of superior pubic ramus with extension into pelvis and proximal thigh.

Hydatid disease is caused by the tapeworm of genus ;Echinococcus. Genus Echinococcus has different species including Echinococcus vogeli, Echinococcus granulosus and Echinococcus multilucularis. Echinococcus granulosus is the most common cause of hydatid disease in humans. This disease can take place either directly through ingestion of parasite eggs from contact with infected dogs or indirectly from the ingestion of contaminated water or food. Infestation of hydatid disease in humans most commonly occurs in the liver (55-70%), followed by the lungs (18-35%). Bone hydatidosis however is very rare,whenever it occurs; it is usually secondary to visceral involvement. We present herein a case of primary hydatid cyst involving superior pubic ramus in a 43 years male patient, which is not a common site for the occurrence of this disease. Diagnosis is usually delayed if high index of suspicion is not there. MRI is a good tool for reaching diagnoses.

Outcome of supracondylar fractures of the humerus in children treated by closed reduction and percutaneous pinning.

Supracondylar fractures of humerus in children are common injuries. Displaced fractures are inherently unstable. Conservative treatment results in malunion. Open reduction and internal fixation (ORIF) is more invasive and recovery is prolonged. From September 2004 to September 2005, 102 displaced supracondylar fractures of humerus, aged between one and half year to 13 years, were treated using close reduction and percutaneous Kirschner (K) wire fixation under c-arm fluoroscopy. Seventy nine patients were treated by cross K-wires and in twenty three cases lateral two K-wires were put. Above elbow plaster of paris back slab was applied in all cases for at least four weeks. Back slab, K-wires were removed after four weeks and elbow range of motion exercise was started. Results were analyzed using Flynn's criteria. All patients were followed up to 14th week postoperatively. In cross K-wire group(N=79) 70.8% had excellent, 22.7% good, 3.8% fair and 2.5% had poor results at eight weeks follow up which was improved to 91.1% excellent, 6.3 good, 1.2% fair and 1.26% poor results at 14 weeks follow up. In lateral K-wire group (N=23) 70% had excellent, 21.7% good, 4.3% fair and 4.3% had poor result at eighth week which was improved to 91.3% excellent, 4.3% good, 4.3% fair and no poor result at 14th week follow up. Eight patients got superficial pin tract infection and seven patients sustained ulnar nerve injury post operatively. We recommend this procedure for displaced supracondylar fractures in children as it is safe and cost effective procedure with acceptable complication rates.

Surgical treatment of isthmic spondylolisthesis with radicular pain in adults.

A common consensus has not yet been reached on surgical management of isthmic Spondylolisthesis especially regarding the optimal surgical procedure. This prospective study was carried to see the outcome of Posterolateral fusion with instrumentation without decompression. Eight consecutive patients, aged between 43 to 55 years, underwent primary surgery for isolated L4, L5 lumbar isthmic Spondylolisthesis of less than grade II that presented with radicular pain and exhibited instability on dynamic radiograph. The surgical procedure consisted of instrumentation with pedicle screws and rods (Moss Miami System) and posterolateral fusion in situ by placement of autogeneous bone graft, harvested from posterior iliac crest. Postoperatively Clinical and Radiological status were assessed and were graded according to Stauffer and Coventry method. The patients were followed up for one to three years. Radiological evidence of fusion was clearly evident by six months in all cases. Symptomatically all were relieved of radicular pain completely. One patient had recurrent backache due to causes unrelated to the illness of surgical procedure requiring occasional analgesic. No serious complication was encountered. This lead to conclusion that in adults of our population with low grade isthmic spondylolisthesis and radicular pain Instrumentation with Posterolateral fusion without decompression was sufficient to relieve symptoms.

An uncommon case of neck fistula.

Congenital fistulae of the neck are branchial in origin and of these 2nd arch fistula is by far the most common, 3rd and 4th arch fistulae being very rare. Here, a case of fistula present since birth and extending from the neck, near the midline to the alveololingual sulcus, considered very rare, is presented. The patient was a 32-year-old male having sticky discharge through an opening in the upper part of the neck. Examination revealed an opening of approximately 1 mm diameter about 1 cm to the left of the midline just above the hyoid bone. A sinogram revealed a fistulous linear tract communicating with the oral cavity. Surgery was undertaken and the fistulous tract was excised.

Detection of tomato leaf curl geminivirus in its vector Bemisia tabaci.

Geminiviruses are single-stranded DNA plant infecting viruses that cause major losses in important crops in tropical and subtropical countries. Tomato leaf curl virus (TLCV) belonging to the genera Begomovirus, is a whitefly-transmitted geminivirus that causes a severe leaf curl disease in tomato (Lycopersicon esculentum). The importance of this disease has prompted a great need for a rapid identification of TLCV in its hosts and vector. Polymerase chain reaction (PCR) is the most sensitive approach to detect a minute amount of viral nucleic acid. It is the most ideal method to amplify geminiviruses as they replicate via a double-stranded, circular DNA form. In this study, geminivirus specific degenerated primers were employed to detect TLCV occurring in its vector whitefly Bemisia tabaci by PCR based approach. One primer pair, amplified TLCV DNA fragment of about 1.1 Kb representing partly replicase gene, intergenic region and partly coat protein gene was used. When a set of primer targeted to the core region of the coat protein gene of geminivirus was used, a PCR amplified fragment of about 0.5 Kb was obtained. This approach is highly useful for an early detection of TLCV occurring in very small amount in the vector B. tabaci. Its implications in geminivirus management strategies and their differentiation and being discussed.

Detection of plant viruses--biotechnological and molecular advances.

Recent advances in biotechnology and molecular biology have played a significant role in development of rapid, specific and sensitive assays for detection of plant viruses. Production of monospecific polyclonal antibodies, monoclonal antibodies have enabled to group isolates of viruses and distinction of closely related strains. In cDNA hybridization applications, there is an increasing interest to employ non-radioactive probes for detection of nucleic acids. Detection limit of nucleic acid is remarkably comparable to those of radioactive labelled probes. Application of polymerase chain reaction (PCR) has made it possible to amplify the low numbers of viral RNA/DNA molecules and their subsequent detection. Underlying principles, their advantages and disadvantages for application of monospecific polyclonal antibodies, hybridoma technology, molecular hybridization and PCR technology with reference to detection of plant viruses have been discussed in this review.

Long term performance of atrial leads.

Long term performance of 163 atrial leads implanted in 158 patients between July 1981 and June 1993 was evaluated. There were 122 DDD and 36 AAI units, with 125 (77%) polyurethane and 38 (23%) silicone leads. One hundred and nine (67%) unipolar and 54 (33%) bipolar leads were used. Patients were followed in the Pacemaker Clinic for 6 to 124 months (mean 50 +/- 39 months). Five patients were lost to follow up. Transient malfunction was observed in 18 cases (sensing 13, pacing 5) within the first 2 weeks. In 13 cases failure to sense subsided spontaneously and in 4 pacing malfunction could be corrected by reprogramming. Lead dislodgement occurred in 4 patients (2.5%), all within the first week. After the 1st month malfunction was uncommon. Between 1 and 12 months undersensing occurred in 4 (2.5%). In 3 cases it could be corrected by reprogramming. In the first year, reoperation was performed in 5 cases for lead related problems (3 dislodgements, 2 insulation failures). Beyond 12 months complications were as follows: failure to sense-8 (5%), failure to pace-3 (2%), insulation break -1 (0.6%). Majority of these problems could be managed by reprogramming. Reoperation was performed in 1 case with insulation break. The pacing mode had to be changed in 5 (3%) patients with dual chamber units who had loss of P wave sensing. During follow-up 98%, 98%, 96%, 95% and 83% of the leads were working satisfactorily at 1,2,3,4 and 9 years respectively. Thus atrial leads have excellent long term performance and an acceptable rate of late malfunction.

Two-dimensional echocardiographic diagnosis of subaortic aneurysm.

Subaortic aneurysms are uncommon and most cases have been reported among black Africans. The present report relates to our experience with three patients having subaortic annular aneurysms, two of congenital origin and one following infective endocarditis of the aortic valve. The role of transthoracic 2- dimensional echocardiography in the diagnosis is emphasized.